Biolegend TotalSeq Antibodies - CITE-Seq에 필요한 Antibody 

TotalSeq™ Reagents for Single-Cell Proteogenomics

TotalSeq™ oligo-conjugated antibodies enable measurement of proteins at a single cell level and integrate seamlessly into existing single-cell RNA sequencing workflows, including Drop-Seq and those available from 10x Genomics.

 

Discover Antibody-Oligo Formats

Each TotalSeq™ antibody is conjugated to a unique oligonucleotide containing a capture sequence, a clone-specific barcode sequence, and a PCR handle compatible with Illumina® sequencing reagents and instruments. Barcodes are placed between the PCR handle and 3’ flanking sequence. The oligonucleotide sequence that is conjugated to our TotalSeq™ antibodies is also referred to as an Antibody-Derived Tag, or ADT. The oligo sequence that is conjugated to our hashtag reagents is referred to as a Hashtag Oligonucleotide, or HTO.

 

Currently, we offer TotalSeq™-A, -B, and –C formats and continue to work with compatible partners to support new versions of genomics reagents and solutions. All TotalSeq™ products are guaranteed until their expiration date (a minimum of 4 months from the date of receipt).

Understand the Differences between TotalSeq™ Formats

TotalSeq™-A: Designed to work with any sequencing platform that relies on poly-dT oligonucleotides as the mRNA capture method.  TotalSeq™-A antibodies contain a poly-A sequence which mimics a natural mRNA.

 

TotalSeq™-B: Capture sequence is compatible with 10x Genomics Chromium Single Cell Expression Solution 3’ kit with Feature Barcode Technology (v3 or v3.1).

 

TotalSeq™-C: Capture sequence is compatible with the 10x Genomics Chromium Single Cell Immune Profiling Solution (5’) which allows for immune repertoire profiling of T and B cell receptors at a single cell resolution.

 

10x Genomics Solutions compatible with TotalSeq™-B and –C  antibodies contain all necessary reagents to process and amplify both oligos derived from TotalSeq™ reagents and mRNA. When using TotalSeq™-A reagents with the 10x Genomics Single Cell Gene Expression Solution Kits (v2, v3, v3.1), additional reagents for preparation of libraries must be purchased. Please refer to our protocols for a complete list.

 

Compare and Contrast TotalSeq™ Formats

 

	TotalSeq™-A	TotalSeq™-B	TotalSeq™-C
10x Genomics compatibility	Single Cell Gene Expression Solution (3’, v2 and v3) and any system employing the poly-A tail capture method	Single Cell Gene Expression Solution (3’, v3) with Feature Barcoding Technology and 10x Genomics Data Analysis Software1	Single Cell Immune Profiling Solution (5’) with Feature Barcoding technology and 10x Genomics Data Analysis Software1
PCR handle	CCTTGGCACCCGAGAATTCCA	GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNN2	CGGAGATGTGTATAAGAGACAGNNNNNNNNNN
Capture sequence	Poly-A [(A)30*A*A3]	NNNNNNNNNGCTTTAAGGCCGGTCCTAGC*A*A4	NNNNNNNNNCCCATATAAGA*A*A4
Next Generation Sequencing compatibility	Compatible with Illumina instruments	Compatible with Illumina instruments	Compatible with Illumina instruments

 

Notes:

1. 10x Genomics Data Analysis Software does not support cell hashing analysis.
2. N represents a randomly selected A, C, G, or T.
3. The symbol * indicates a phosphorothioated bond, to prevent nuclease degradation.
4. These sequences are unique to the TotalSeq™-B and -C conjugates, and were developed independently of the reagents used by researchers at the New York Genome Center (NYGC, CITE-seq.com). TotalSeq™-B, -C, and the antibodies used by NYGC are all compatible with 10x Genomics solutions but utilize different oligo sequences.  As such, protocols and additional reagents, including required primers, differ between the antibody formats.  Please refer to our protocols when using TotalSeq™ reagents.